Skip to main content

Advertisement

Table 1 Primer sequences used for the RQ-PCR analysis

From: Fish biomarkers from a different perspective: evidence of adaptive strategy of Abramis brama (L.) to chemical stress

GenePrimer sequence (5′–3′)Published inPrimer efficiency
Endogenous control
 40s11F:CCGTGGGTGACATCGTTACA
R:TCAGGACATTGAACCTCACTGTCT
[30]a2.05
General stress
 hsp70F:GGCAGAAAGTTTGATGACCCA
R:GCAATCTCCTTCATCTTCACC
[31]a2.09
 cox1F:GGAACTTAGCCCACGCA
R: AAGCACGGATCAGACGA
[31]a1.92
 erk2F:GTTGAAGACGCAGCACTTGA
R:ACAGGTTTGATGGCTTCAGG
[32]b2.00
 crF:GTGAGACTGCAAGTGTCCAA
R: TCTCTCTTCACTATGGCCT
[31]a1.97
Antioxidative defence
 sodF:GAGTTCGACAACACAATCTATGCCAC
R: CAGCCTTGACTGAGGTCTCC
[33]c2.01
 gpx1F:AGATGTCATTCCTGCACACG
R:AAGGAGAAGCTTCCTCAGCC
[34]b2.07
 nrf2aF:GAGCGGGAGAAATCACACAGAATG
R:CAGGAGCTGCATGCACTCATCG
[35]b1.96
Xenobiotic metabolism
 cyp1aF: TTCGGAGCCGGTTTCGACAC
R: CCTCGAGGAGCGGCAGG
[33]c1.98
 mgst3aF:GATATGTGGCGCTAACCGGA
R:ACTGTACATTGTTGGATACGG
[36]b2.00
Endocrine disruption
 erαF:ACTGCCCACAAACTCTCACC
R:TGGGAACTCATAGGCTCCAT
[30]a2.05
 erβF:CCAGGTCCATTTGTTGGAGT
R:TGAGGTCTGGGGAGAAAATG
[30]a2.04
Glucose homeostasis
 pcF: GTAAAGGTGAAGCCAGGCCAG
R: TCCCCTTCCAGGCTGCTGTC
[33]c2.01
 pyglF: TGGCCAATCACAGGATCGTTA
R: TTCTCAATTGCCTCCACGTCA
[33]c2.02
Iron homeostasis
 tfdF: GGCACACTGGCAAGTTTACAT
R: GGCTTTCAGGTGTCTTGCAG
[33]c2.09
Neurotoxicity
 mbpF: AATCAGCAGGTTCTTCGGAGGAGA
R: AAGAAATGCACGACAGGGTTGACG
[37]b1.91
  1. aCyprinus carpio-, bDanio rerio- and cRutilus rutilus-specific sequences