Skip to main content

Table 1 Primer sequences of OsPCR1 for qRT-PCR

From: A novel family of PLAC8 motif-containing/PCR genes mediates Cd tolerance and Cd accumulation in rice

Primer name Gene Forward sequence (5′ → 3′) Reverse sequence (5′ → 3′)
OsPCR1 Os02g0578900 GCCAAGATGCGGTCCCAGTA GCGTGCCATCCGAGGTTCAT
OsPCR3 Os02g0763000 TTCCTCGTCCATTTCTGCTGC CGCCTCTGCCTGTCCACATT