Skip to main content

Advertisement

Table 1 PCR primers used for analysis of gene expression

From: Liver toxicity assessments in rats following sub-chronic oral exposure to copper nanoparticles

Target Sequences of primers (5′ to 3′) Base number
CYP450 1A2 F GGTGGAATCGGTGGCTAAT 19
CYP450 1A2 R AGTCCTTGCTGCTCTTCACG 20
CYP450 2C11 F AATCCGCAGTCTGAGTTTACCC 22
CYP450 2C11 R GGTTTCTGCCAATTACACGTTCT 23
CYP450 2D6 F AGCTTCAACACCGCTATGGT 20
CYP450 2D6 R CAGCAGTGTCCTCTCCATGA 20
CYP450 2E1 F CCTTTCCCTCTTCCCATCC 19
CYP450 2E1 R AACCTCCGCACATCCTTCC 19
CYP450 3A1 F TGCCATCACGGACACAGA 18
CYP450 3A1 R ATCTCTTCCACTCCTCATCCTTAG 24
PXR R TGATGACGCCCTTGAACATG 20
CAR F CCACGGGCTATCATTTCCAT 20
CAR R CCCAGCAAACGGACAGATG 19
AHR F TGGACAAACTCTCCGTTCTAAGG 23
AHR R GATTTTAATGCAACATCAAAGAAGCT 26
GAPDH F GATGGTGAAGGTCGGTGTG 19
GAPDH R ATGAAGGGGTCGTTGATGG 19