Skip to main content

Table 5 Location in the genome, miRNA sequence and number of mapped reads for the 20 putative novel miRNAs identified in maize varieties

From: Systematic miRNome profiling reveals differential microRNAs in transgenic maize metabolism

miRNA ID Location on genome miRNA sequence Read count from miR-PREFeR Ct from RT-qPCR
RR Bt RR×Bt Control RR Bt RR×Bt Control
zma-miRX01 chr01|95866804: 95866892 AUGGAGUGGAUUGAGGGGGCU 36 51 43 50
zma-miRX02 chr01|224709986:224710116 AUCCGGUACAAACGAACAAGGCCU 168 179 162 130
zma-miRX03 chr10|5127325: 5127461 AGAGUGGACAGUUGACGCCGGCCC 0 0 0 152 22.0 21.4 21.6 21.9
zma-miRX04 chr10|12355028: 12355155 AAUACAUGUGGAUUGAGCUCAAUA 42 57 43 45
zma-miRX05 chr10|71614450: 71614580 AUCCGACAGAAACGAACAAGGCCU 615 0 0 607 24.8 24.4 24.7 25.2
zma-miRX06 chr10|120859137:120859262 UAUUCGAGAACGGAUGUAGUACAU 546 672 655 525 31.1 33.9 31.1 33.9
zma-miRX07 chr10|145006838:145006964 AUUAGGGUAGAACCGAACAAGCCU 50 55 56 65
zma-miRX08 chr02|30270820: 30270916 AAUACAUGUGGAUUGAGCUCAAUA 42 57 43 45
zma-miRX09 chr02|144495862:144495992 AUCCGACGCAAACGAACAAGGCCU 78 109 102 68
zma-miRX10 chr02|203809131:203809256 AGGGUAUUGAUAGGACUAUAAUCC 352 351 323 373 28.6 28.1 29.5 28.9
zma-miRX11 chr02|229799695:229799756 GGGGAUGUAGUUCAGAUGGUAGAA 5893 0 0 0 29.7 30.1 29.5 29.7
zma-miRX12 chr03|162601521:162601594 UGUUUGGGAUUAUAAUCUGCC 47 71 48 56
zma-miRX13 chr03|178085743:178085863 AAAUACUGUAGAAGCCGCAGCCGC 0 2937 0 0 17.2
zma-miRX14 chr04|100693925:100694040 AGAGUGGACAGUUGACGCCGGCCC 0 0 0 152
zma-miRX15 chr05|144731639:144731774 ACGAGAGAGGACGUCAGGGGACGA 11 29 27 27
zma-MIR16 chr05|174841383:174841471 chr05|174842606:174842694 chr05|174912223:174912311 chr05|174938499:174938587 CUGAGCAAAAAAACACGACUAAG 21 26 23 16
zma-MIR17 chr07|104640325:104640456 AUUCCGGAACAAACGAACACACCC 18 17 18 28
zma-MIR18 chr07|123915132:123915213 UUUGAGAUUCGUAGCUUUUAC 77 79 95 77
zma-MIR19 chr08|61110522: 61110652 AUCUGACACAAACGAACAAGGCCU 82 92 94 77
zma-MIR20 chr08|171925082:171925167 ACGGAUCAAAUCUAUGGUGAGAUU 53 78 59 58 35.1 36.2 34.7 35.1
  1. miRNA zma-miRX03 and zma-miRX14, as well as zma-miRX04 and zma-miRX08, show identical mature sequences, but their pre-miRNAs have different sequences. “–” means either no available primer for that miRNA sequence or unspecific melting curve